Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Article Abstract:

The distamycin A-sensitive fragile site FRA16B is due to the expansion of perfect-repeat copies of the 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(super c/sub a)TA)sub n, located at the site of repeat-copy number polymorphism in the normal population. This was gleaned from the isolation by positional cloning of FRA16B and comparison with folate-sensitive fragile sites, which found that the FRA16B repeat motif has striking homology with the polymorphic variable number tandem repeat at the COL2A1 collagen gene locus. Findings also indicate that the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats.

Analysis, Nucleotide sequence, Base sequence, Chromosomes, Human chromosome abnormalities

---

Molecular and biological characterization of a ligand for CD27 defines a new family of cytokines with homology to tumor necrosis factor

Article Abstract:

A fusion protein consisting of the extracellular domain of CD27 and the constant domain of a human immunoglobulin G1 molecule was used as a probe for the isolation of a cDNA encoding a ligand for CD27. CD27 is T and B cell surface antigen. The ligand for CD27, which was identified and cloned from an Epstein-Barr virus-transformed human B cell line, encodes for a type II transmembrane protein homologous to the tumor necrosis factor and the ligand for CD40. Biological characterization of the ligand suggests a role in the maturation of T cells.

Cloning, T cells, Cell surface antigens

---

Fragile sites--cytogenetic similarity with molecular diversity

Article Abstract:

Fragile sites involve both cytogenetic similarity and molecular diversity. Some common fragile sites may affect gene expression, setting up local regions of instability. Understanding mechanisms of the instability and the biological significance is a challenge. Just three of the various classes of rare fragile sites have been studied from the molecular perspective and more is known about the folate-sensitive ones than others. Fragile sites are classified with some cytogenetic and molecular properties.

Australia, Physiological aspects, Gene mutations, Gene mutation, Chromosome mapping, Mutation (Biology), Mutation, Genetic disorders, Cytogenetics, Familial diseases

Similar abstracts:

• Abstracts: Molecular mechanism of Angelman syndrome in two large families involves an imprinting mutation. A new genetic disorder in mitochondria fatty acid [beta]-oxidation: ACAD9 deficiency
• Abstracts: Interchromosomal transfer of epigenetic states in Ascobolus: transfer of DNA methylation is mechanistically related to homologous recombination
• Abstracts: The Spemann organizer signal noggin binds and inactivates bone morphogenetic protein 4. A nodal-related gene defines a physical and functional domain within the Spemann organizer
• Abstracts: Transcriptional regulation of the Escherichia coli rhaT gene. The gene yghK linked to the glc operon of Escherichia coli encodes a permease for glycolate that is structurally and functionally similar to L-lactate permease
• Abstracts: When checkpoints fail. CDC5 and CKII control adaptation to the yeast DNA damage checkpoint. A checkpoint regulates the rate of progression through S phase in S. cerevisiae in response to DNA damage

This website is not affiliated with document authors or copyright owners. This page is provided for informational purposes only. Unintentional errors are possible.